Skip to main content
Addgene

3xMS2 TR knockin sgRNA 2
(Plasmid #207608)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207608 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX330 Addgene #42230
  • Total vector size (bp) 8500
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    acccccaaacctgactgact
  • Species
    H. sapiens (human)
  • Promoter CMV and U6
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)
  • 3′ cloning site BbsI (unknown if destroyed)
  • 5′ sequencing primer U6 forward
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3xMS2 TR knockin sgRNA 2 was a gift from Jens Schmidt (Addgene plasmid # 207608 ; http://n2t.net/addgene:207608 ; RRID:Addgene_207608)
  • For your References section:

    TCAB1 prevents nucleolar accumulation of the telomerase RNA to facilitate telomerase assembly. Klump BM, Perez GI, Patrick EM, Adams-Boone K, Cohen SB, Han L, Yu K, Schmidt JC. Cell Rep. 2023 Jun 1;42(6):112577. doi: 10.1016/j.celrep.2023.112577. 10.1016/j.celrep.2023.112577 PubMed 37267110