pS12<ActB.mus_2A-mCh_KI-HMEJ
(Plasmid #207407)

• Purpose: Donor template to knock in mCherry at the C-terminus of mouse ActB (β-Actin) using DSB repair by homology-mediated end joining (HMEJ). [Lab plasmid ID: TU148]
• Depositing Lab: Alexandros Poulopoulos
• Publication: Richardson et al CRISPR J. 2023 Oct;6(5):447-461. doi: 10.1089/crispr.2023.0036. Epub 2023 Sep 15.

Backbone

• Vector backbone: pS12
• Backbone size w/o insert (bp): 2134
• Total vector size (bp): 4312
• Vector type: Mouse Targeting, CRISPR ; HMEJ knockin donor

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Actb
• Alt name: β-Actin
• Species: M. musculus (mouse)
• Insert Size (bp): 2178
• Entrez Gene: Actb (a.k.a. Actx, E430023M04Rik, beta-actin)
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GGGTTATTGTCTCATGAGCGG
• 3′ sequencing primer: ATTATACAATACTACAAGCATAAAAACGCA

Resource Information

• Supplemental Documents:
  • pS12<ActB.mus_2A-mCh_KI-HMEJ [TU148].gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2020.07.15.199620 for bioRxiv preprint.

Please note: Addgene NGS was not able to fully resolve the poly-T region of the ActB HA-R. The plasmid was successfully used as a donor by the depositing lab.