Skip to main content
Addgene

pSmart-EF1alpha-NlaCas7-p65
(Plasmid #207394)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207394 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSmart HC Kan
  • Backbone manufacturer
    Lucigen
  • Backbone size w/o insert (bp) 1993
  • Total vector size (bp) 4859
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EF1a-NlaCas7-p65-bGH polyA
  • Insert Size (bp)
    2866
  • Promoter EF1a
  • Tags / Fusion Proteins
    • NLS
    • HA

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGACCATCGAGAAGCGCTA
  • 3′ sequencing primer gctggcaactagaaggcaca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSmart-EF1alpha-NlaCas7-p65 was a gift from Yan Zhang (Addgene plasmid # 207394 ; http://n2t.net/addgene:207394 ; RRID:Addgene_207394)
  • For your References section:

    Exploiting activation and inactivation mechanisms in type I-C CRISPR-Cas3 for genome-editing applications. Hu C, Myers MT, Zhou X, Hou Z, Lozen ML, Nam KH, Zhang Y, Ke A. Mol Cell. 2024 Feb 1;84(3):463-475.e5. doi: 10.1016/j.molcel.2023.12.034. Epub 2024 Jan 18. 10.1016/j.molcel.2023.12.034 PubMed 38242128