Thy1 promoter construct
(Plasmid #20736)

• Depositing Lab: Joshua Sanes
• Publication: Feng et al Neuron. 2000 Oct . 28(1):41-51.

Backbone

• Vector backbone: pTS(2)
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Thy1 promoter
• Alt name: Thy-1.2
• Species: M. musculus (mouse)
• Insert Size (bp): 6500
• GenBank ID:
• Entrez Gene: Thy1 (a.k.a. CD90, T25, Thy-1, Thy-1.2, Thy1.1, Thy1.2)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: PvuI (unknown if destroyed)
• 5′ sequencing primer: Thy1F1 (TCTGAGTGGCAAAGGACCTTAGG)
• 3′ sequencing primer: n/a

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Pico Caroni, FMI
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Contains 6.5 kb of the murine thy1.2 gene, extending from the promoter to the intron following exon 4, but lacking exon 3 and its flanking introns (see Figure 1 in Caroni 1997).

P. Caroni, Overexpression of growth-associated proteins in the neurons of adult transgenic mice. J. Neurosci. Methods 71 (1997), pp. 3–9 https://www.ncbi.nlm.nih.gov/pubmed/9125370