Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Dox-SOScat
(Plasmid #207329)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207329 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PiggyBac
  • Backbone manufacturer
    System Biosciences
  • Backbone size w/o insert (bp) 3093
  • Total vector size (bp) 10199
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    son of sevenless homolog 2 variant, catalytic domain
  • Alt name
    SOScat
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1461
  • Mutation
    range: 593 to 1078
  • Promoter Tet Response Element
  • Tag / Fusion Protein
    • myristoylation tag - BFP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCGTCGACTAGTCCAGTGTG
  • 3′ sequencing primer CCCACTGACGGGCACCGGAG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Dox-SOScat was a gift from Jared Toettcher (Addgene plasmid # 207329 ; http://n2t.net/addgene:207329 ; RRID:Addgene_207329)
  • For your References section:

    Control of gastruloid patterning and morphogenesis by the Erk and Akt signaling pathways. Underhill EJ, Toettcher JE. Development. 2023 Aug 15;150(16):dev201663. doi: 10.1242/dev.201663. Epub 2023 Aug 17. 10.1242/dev.201663 PubMed 37590131