Dox-Akt
(Plasmid #207328)

• Purpose: PiggyBac vector backbone encoding doxycycline-inducible expression of membrane-localized Akt1 (without pleckstrin homology domain)
• Depositing Lab: Jared Toettcher
• Publication: Underhill et al Development. 2023 Aug 15;150(16):dev201663. doi: 10.1242/dev.201663. Epub 2023 Aug 17.

Backbone

• Vector backbone: PiggyBac
• Backbone manufacturer: System Biosciences
• Backbone size w/o insert (bp): 3093
• Total vector size (bp): 9827
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: rac protein kinase-alpha
• Alt name: AKT1
• Species: H. sapiens (human)
• Insert Size (bp): 1110
• Mutation: range: 129 - 480
• Entrez Gene: AKT1 (a.k.a. AKT, PKB, PKB-ALPHA, PRKBA, RAC, RAC-ALPHA)
• Promoter: Tet Response Element
• Tag / Fusion Protein:
  • myristoylation tag - BFP (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCGTCGACTAGTCCAGTGTG
• 3′ sequencing primer: CCCACTGACGGGCACCGGAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: Plasmid contains a G130E mutation in AKT1 compared to the NCBI reference sequence AAA36539.1. This mutation is not known to affect plasmid function.