iNos-eGFP
(Plasmid
#207251)
-
PurposeReporter for expression of eGFP under control of iNos promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207251 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRRLSIN.cPPT.PGK-GFP.WPRE
-
Backbone manufacturerTrono Lab
- Backbone size w/o insert (bp) 7388
- Total vector size (bp) 8669
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiNos Promoter
-
Alt nameiNos
-
Alt nameinducible nitric oxide synthase
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1825
-
Entrez GeneNos2 (a.k.a. MAC-NOS, NOS-II, Nos-2, Nos2a, i-NOS, iNOS)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CCGCTCGAGCGGCGAGCTCTTACGCGGACTTT
- 3′ sequencing primer CGCGGATCCGCGTTTACCAACAGTACCGGAAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To generate the iNos-eGFP plasmid, a 1825 -bp XhoI/BamHI fragment was isolated from a ppGL2-NOS2 Promoter-Luciferase construct (Addgene plasmid # 19296, deposited by Charles Lowenste). The iNos fragment was subcloned into the lentiviral construct pRRLSIN.cPPT.PGK-GFP.WPRE (Addgene plasmid #12252, deposited by Didier Trono to generate a PER2-luciferase reporter construct.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
iNos-eGFP was a gift from Michelle Farkas (Addgene plasmid # 207251 ; http://n2t.net/addgene:207251 ; RRID:Addgene_207251) -
For your References section:
Murine macrophage-based iNos reporter reveals polarization and reprogramming in the context of breast cancer. Mas-Rosario JA, Medor JD, Jeffway MI, Martinez-Montes JM, Farkas ME. Front Oncol. 2023 Apr 5;13:1151384. doi: 10.3389/fonc.2023.1151384. eCollection 2023. 10.3389/fonc.2023.1151384 PubMed 37091169