eA3Ai-Cas9n-UGI-NLS
(Plasmid
#207165)
-
PurposeExpress A3A with an N57G point mutation and an intron in a BE3-based base editor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207165 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneBE3
- Backbone size w/o insert (bp) 9321
- Total vector size (bp) 10497
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3A
-
Alt nameAPOBEC3A
-
Alt nameA3A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1496
-
MutationN57G
-
GenBank IDNM_145699
-
Entrez GeneAPOBEC3A (a.k.a. A3A, ARP3, PHRBN, bK150C2.1)
- Promoter CMV
-
Tag
/ Fusion Protein
- Cas9-UGI--NLS (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer tagaaggcacagtcgagg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eA3Ai-Cas9n-UGI-NLS was a gift from Reuben Harris (Addgene plasmid # 207165 ; http://n2t.net/addgene:207165 ; RRID:Addgene_207165) -
For your References section:
APOBEC Reporter Systems for Evaluating diNucleotide Editing Levels. Rieffer AE, Chen Y, Salamango DJ, Moraes SN, Harris RS. CRISPR J. 2023 Oct;6(5):430-446. doi: 10.1089/crispr.2023.0027. Epub 2023 Sep 6. 10.1089/crispr.2023.0027 PubMed 37672599