LAMP1-mCherry-FRB*
(Plasmid #207145)

• Purpose: Lysosome-targeted rapalog dimerizer
• Depositing Lab: Antony Galione
• Publication: Davis et al EMBO J. 2020 Jul 15;39(14):e104058. doi: 10.15252/embj.2019104058. Epub 2020 Jun 8.

Backbone

• Vector backbone: pEGFP
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 6263
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LAMP1
• Alt name: Lysosome associated membrane protein 1
• Species: H. sapiens (human)
• Insert Size (bp): 1251
• Mutation: Silent mutation
• GenBank ID: 3916
• Entrez Gene: LAMP1 (a.k.a. CD107a, LAMPA, LGP120)
• Promoter: CMV
• Tags / Fusion Proteins:
  • mCherry (C terminal on insert)
  • FRB* (T2098L mutant of FKBP-rapamycin binding domain) (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CAACGGGACTTTCCAAAATG
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• Supplemental Documents:
  • LAMP1-mCherry-FRB.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry