pMMK803
(Plasmid
#207138)
-
PurposeAssembled Tn10 with CP25 promoter driving gfp
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207138 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMMK810
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTn10-CP25-GFP
-
SpeciesSynthetic
- Promoter CP25
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATTCAACGGGAAACGTCTTG (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see Alker et al. 2023 mBio (https://doi.org/10.1128/mbio.01502-23) for more information on the Marine Modification Kit plasmids.
Please visit https://www.biorxiv.org/content/10.1101/2023.05.08.539906v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMMK803 was a gift from Nicholas Shikuma (Addgene plasmid # 207138 ; http://n2t.net/addgene:207138 ; RRID:Addgene_207138) -
For your References section:
Linking bacterial tetrabromopyrrole biosynthesis to coral metamorphosis. Alker AT, Farrell MV, Demko AM, Purdy TN, Adak S, Moore BS, Sneed JM, Paul VJ, Shikuma NJ. ISME Commun. 2023 Sep 19;3(1):98. doi: 10.1038/s43705-023-00309-6. 10.1038/s43705-023-00309-6 PubMed 37726481