Skip to main content
Addgene

pmirGLO-3'UTR mouse Il13 mutDRACH
(Plasmid #207130)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207130 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pmirGLO Dual-Luciferase miRNA Target Expression Vector
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 7362
  • Total vector size (bp) 8091
  • Modifications to backbone
    added EcoRI and SmaI restriction enzyme sites in the multiple cloning site
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Interleukin 13 (Il13) 3'UTR
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    741
  • Mutation
    TGAGGAGAGACCATCCCTGGGCATCTCAGCTGTGGACTCATTTTCCTTTCTCACATCAGACTTT to TGAGGAGAGcgCtTCCCTGGGCATCTCAGCTGTGGtacCATTTTCCTTTCTCACATCAagCTTT - 1st DRACH site mutated contains AfeI restriction site, 2d DRACH contains KpnI restriction site and 3d DRACH site mutated contains HindIII restriction site.
  • GenBank ID
    NM_008355.3
  • Entrez Gene
    Il13 (a.k.a. Il-13)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmirGLO-3'UTR mouse Il13 mutDRACH was a gift from Silvia Monticelli (Addgene plasmid # 207130 ; http://n2t.net/addgene:207130 ; RRID:Addgene_207130)

  • For your References section:

    The mRNA methyltransferase Mettl3 modulates cytokine mRNA stability and limits functional responses in mast cells. Leoni C, Bataclan M, Ito-Kureha T, Heissmeyer V, Monticelli S. Nat Commun. 2023 Jun 29;14(1):3862. doi: 10.1038/s41467-023-39614-y. 10.1038/s41467-023-39614-y PubMed 37386028
Related items: