plVX-EF1a-FLAG-hMETTL3-IRES-ZsGreen
(Plasmid
#207123)
-
PurposeLentiviral vector to express human METTL3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207123 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneplVx-EF1a-IRES-ZsGreen
-
Backbone manufacturer8889
- Total vector size (bp) 10655
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehMETTL3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1807
-
GenBank IDNM_019852.5
-
Entrez GeneMETTL3 (a.k.a. IME4, M6A, MT-A70, Spo8, hMETTL3)
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CGTATATAAGTGCAGTAGTCG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byInsert was subcloned from Addgene plasmid #53739
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plVX-EF1a-FLAG-hMETTL3-IRES-ZsGreen was a gift from Silvia Monticelli (Addgene plasmid # 207123 ; http://n2t.net/addgene:207123 ; RRID:Addgene_207123) -
For your References section:
The mRNA methyltransferase Mettl3 modulates cytokine mRNA stability and limits functional responses in mast cells. Leoni C, Bataclan M, Ito-Kureha T, Heissmeyer V, Monticelli S. Nat Commun. 2023 Jun 29;14(1):3862. doi: 10.1038/s41467-023-39614-y. 10.1038/s41467-023-39614-y PubMed 37386028