Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

plVX-EF1a-FLAG-hMETTL3-IRES-ZsGreen
(Plasmid #207123)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207123 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    plVx-EF1a-IRES-ZsGreen
  • Backbone manufacturer
    8889
  • Total vector size (bp) 10655
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hMETTL3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1807
  • GenBank ID
    NM_019852.5
  • Entrez Gene
    METTL3 (a.k.a. IME4, M6A, MT-A70, Spo8, hMETTL3)
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGTATATAAGTGCAGTAGTCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Insert was subcloned from Addgene plasmid #53739

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    plVX-EF1a-FLAG-hMETTL3-IRES-ZsGreen was a gift from Silvia Monticelli (Addgene plasmid # 207123 ; http://n2t.net/addgene:207123 ; RRID:Addgene_207123)
  • For your References section:

    The mRNA methyltransferase Mettl3 modulates cytokine mRNA stability and limits functional responses in mast cells. Leoni C, Bataclan M, Ito-Kureha T, Heissmeyer V, Monticelli S. Nat Commun. 2023 Jun 29;14(1):3862. doi: 10.1038/s41467-023-39614-y. 10.1038/s41467-023-39614-y PubMed 37386028