SHLD1 N-terminal sgRNA
(Plasmid
#207101)
-
PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207101 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330 Addgene #42230
- Backbone size w/o insert (bp) 8484
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATGGCAGGACTATGGCAGCC
-
SpeciesH. sapiens (human)
- Promoter CMV and U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (unknown if destroyed)
- 3′ cloning site BbsI (unknown if destroyed)
- 5′ sequencing primer U6 forward (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SHLD1 N-terminal sgRNA was a gift from Jens Schmidt (Addgene plasmid # 207101 ; http://n2t.net/addgene:207101 ; RRID:Addgene_207101) -
For your References section:
Systematic analysis of the molecular and biophysical properties of key DNA damage response factors. Heyza JR, Mikhova M, Bahl A, Broadbent DG, Schmidt JC. Elife. 2023 Jun 21;12:e87086. doi: 10.7554/eLife.87086. 10.7554/eLife.87086 PubMed 37341699