Skip to main content
Addgene

NBS1 C-terminal sgRNA
(Plasmid #207092)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207092 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX330 Addgene #42230
  • Backbone size w/o insert (bp) 8484
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TAAAAAGGAGAAGATAACTG
  • Species
    H. sapiens (human)
  • Promoter CMV and U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)
  • 3′ cloning site BbsI (unknown if destroyed)
  • 5′ sequencing primer U6 forward
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NBS1 C-terminal sgRNA was a gift from Jens Schmidt (Addgene plasmid # 207092 ; http://n2t.net/addgene:207092 ; RRID:Addgene_207092)
  • For your References section:

    Systematic analysis of the molecular and biophysical properties of key DNA damage response factors. Heyza JR, Mikhova M, Bahl A, Broadbent DG, Schmidt JC. Elife. 2023 Jun 21;12:e87086. doi: 10.7554/eLife.87086. 10.7554/eLife.87086 PubMed 37341699