Skip to main content
Addgene

RNF169-Halo HRD
(Plasmid #207083)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207083 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFastBac dual
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 9000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HaloTag followed by BGH PolyA and PuroR cassette flanked by human RNF169 locus sequences
  • Species
    H. sapiens (human), Synthetic
  • Promoter Endogenous
  • Tag / Fusion Protein
    • HaloTag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTTTAAAAAACCTCCCACACCTC
  • 3′ sequencing primer AAA CCA CAA CTA GAA TGC AGT GA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RNF169-Halo HRD was a gift from Jens Schmidt (Addgene plasmid # 207083 ; http://n2t.net/addgene:207083 ; RRID:Addgene_207083)
  • For your References section:

    Systematic analysis of the molecular and biophysical properties of key DNA damage response factors. Heyza JR, Mikhova M, Bahl A, Broadbent DG, Schmidt JC. Elife. 2023 Jun 21;12:e87086. doi: 10.7554/eLife.87086. 10.7554/eLife.87086 PubMed 37341699