pCD-Ugi21
(Plasmid
#207005)
-
PurposepGGC000 Greengate entry vector containing Utricularia gibba insulator 21 (Ugi21) sequence (ID9063)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207005 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGGC000
-
Backbone manufacturerJan Lohmann Lab
- Backbone size w/o insert (bp) 2686
- Total vector size (bp) 3476
-
Vector typeGolden Gate Compatible cloning vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUtricularia gibba insulator 21
-
Alt nameUgi21
-
SpeciesUtricularia gibba
-
Insert Size (bp)788
-
GenBank IDBK063663
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGGCTTTACACTTTATGCTTCCGGC
- 3′ sequencing primer AGGGTTTTCCCAGTCACGACGTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCD-Ugi21 was a gift from Wayne Parrott (Addgene plasmid # 207005 ; http://n2t.net/addgene:207005 ; RRID:Addgene_207005) -
For your References section:
Mining the Utricularia gibba genome for insulator-like elements for genetic engineering. Laspisa D, Llla-Berenguer E, Bang S, Schmitz RJ, Parrott W, Wallace J. Front Plant Sci. 2023 Nov 8;14:1279231. doi: 10.3389/fpls.2023.1279231. eCollection 2023. 10.3389/fpls.2023.1279231 PubMed 38023853