pML45
(Plasmid
#206995)
-
PurposeContains gRNA targeting mouse Ptbp1 gene and Cas9 ORF.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206995 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePtbp1 gRNA
-
gRNA/shRNA sequenceGCCCACAGGCACCTAGATGG
-
SpeciesM. musculus (mouse)
-
Entrez GenePtbp1 (a.k.a. HNRPI, PTB-1, PTB2, PTB3, PTB4, Ptb, pPTB)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pML45 was a gift from Eugene Makeyev (Addgene plasmid # 206995 ; http://n2t.net/addgene:206995 ; RRID:Addgene_206995) -
For your References section:
Protocol for auxin-inducible depletion of the RNA-binding protein PTBP1 in mouse embryonic stem cells. Kainov Y, Zhuravskaya A, Makeyev EV. STAR Protoc. 2023 Oct 18;4(4):102644. doi: 10.1016/j.xpro.2023.102644. 10.1016/j.xpro.2023.102644 PubMed 37862173