Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pML45
(Plasmid #206995)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206995 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX330
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Ptbp1 gRNA
  • gRNA/shRNA sequence
    GCCCACAGGCACCTAGATGG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Ptbp1 (a.k.a. HNRPI, PTB-1, PTB2, PTB3, PTB4, Ptb, pPTB)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pML45 was a gift from Eugene Makeyev (Addgene plasmid # 206995 ; http://n2t.net/addgene:206995 ; RRID:Addgene_206995)
  • For your References section:

    Protocol for auxin-inducible depletion of the RNA-binding protein PTBP1 in mouse embryonic stem cells. Kainov Y, Zhuravskaya A, Makeyev EV. STAR Protoc. 2023 Oct 18;4(4):102644. doi: 10.1016/j.xpro.2023.102644. 10.1016/j.xpro.2023.102644 PubMed 37862173