pDNR-gRNA
(Plasmid
#206990)
-
PurposeA plasmid for expression of SaCas9-sgRNA targeting donor plasmids
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206990 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSB700-SaCas9-gRNA
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDonor plasmid-targeting SaCas9-gRNA
-
gRNA/shRNA sequenceGAATCGACTCGAACTTCGTGTGTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGA
- Promoter U6
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer U6 promoter (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.11.16.516691v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDNR-gRNA was a gift from Alejandro Chavez (Addgene plasmid # 206990 ; http://n2t.net/addgene:206990 ; RRID:Addgene_206990) -
For your References section:
High-throughput tagging of endogenous loci for rapid characterization of protein function. Kim J, Kratz AF, Chen S, Sheng J, Kim HK, Zhang L, Singh BK, Chavez A. Sci Adv. 2024 May 3;10(18):eadg8771. doi: 10.1126/sciadv.adg8771. Epub 2024 May 1. 10.1126/sciadv.adg8771 PubMed 38691600