pAAV-EFS-TadA8e-Sauri-U6-Lmna sgRNA
(Plasmid
#206979)
-
PurposeExpresses SauriABE8e by EFS promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206979 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV-EFS-SauriABE8e-bGH-U6-sgRNA-BsmBI
- Backbone size w/o insert (bp) 7897
- Total vector size (bp) 7897
-
Vector typeAAV ; Adenine Base Editor
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLmna sgRNA
-
Insert Size (bp)20
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgtgccttctagttgccag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EFS-TadA8e-Sauri-U6-Lmna sgRNA was a gift from Yuxuan Guo (Addgene plasmid # 206979 ; http://n2t.net/addgene:206979 ; RRID:Addgene_206979) -
For your References section:
Adenine base editor-based correction of the cardiac pathogenic Lmna c.1621C > T mutation in murine hearts. Yang L, Liu Z, Sun J, Chen Z, Gao F, Guo Y. J Cell Mol Med. 2024 Feb;28(4):e18145. doi: 10.1111/jcmm.18145. 10.1111/jcmm.18145 PubMed 38332517