pAAV-CASI-InteinC-NG C aa714-1368-U6-Lmna sgRNA1
(Plasmid
#206974)
-
PurposeExpresses NG cas9C by the constitutive CASI promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206974 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-CASI-Cas9C
- Backbone size w/o insert (bp) 6849
- Total vector size (bp) 7245
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNG aa714-1368, U6, Lmna sgRNA1
-
Alt nameSplit-NG C-terminal half, U6 promoter and Lmna sgRNA
-
SpeciesSynthetic
-
Insert Size (bp)2579
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggaccctaagaagtacggcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene 138491:ABE8e-NG ;addgene 132778:pU6-Sp-pegRNA-HEK3_CTT_ins
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CASI-InteinC-NG C aa714-1368-U6-Lmna sgRNA1 was a gift from Yuxuan Guo (Addgene plasmid # 206974 ; http://n2t.net/addgene:206974 ; RRID:Addgene_206974) -
For your References section:
Adenine base editor-based correction of the cardiac pathogenic Lmna c.1621C > T mutation in murine hearts. Yang L, Liu Z, Sun J, Chen Z, Gao F, Guo Y. J Cell Mol Med. 2024 Feb;28(4):e18145. doi: 10.1111/jcmm.18145. 10.1111/jcmm.18145 PubMed 38332517