pAAV-CMV-TadA8e-SpG N aa2-713-InteinN
(Plasmid #206968)

• Purpose: Expresses TadA8e and SpG cas9N by the constitutive CMV promoter
• Depositing Lab: Yuxuan Guo
• Publication: Yang et al J Cell Mol Med. 2024 Feb;28(4):e18145. doi: 10.1111/jcmm.18145.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-SMVP-Cas9N
• Backbone size w/o insert (bp): 7010
• Total vector size (bp): 7172
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CMV, TadA8e, SpG N
• Alt name: TadA8e, Split-SpG N-terminal half and CMV
• Species: Synthetic
• Insert Size (bp): 1526

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggaatgtgtgtcagttagggt

Resource Information

• Supplemental Documents:
  • Annotated Depositor Sequence
• A portion of this plasmid was derived from a plasmid made by: Addgene 140002: pCMV-T7-ABEmax(7.10)-SpG-P2A-EGFP (RTW4562); Addgene 138491: ABE8e-NG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry