pcDNA3.1_hMed25
(Plasmid #206958)

• Purpose: The ORF of human Med25 cDNA amplified from the RT human liver RNA was cloned into pGEMTE vector and then subclone at XhoI/XbaI sites of the pcDNA3.2(+), the mammalian expression vector.
• Depositing Labs: Catharine Ross, Reza Zolfaghari
• Publication: Zolfaghari and Ross plasmids (unpublished)

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5428
• Total vector size (bp): 7760
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Homo sapiens mediator complex subunit 25 (MED25), transcript variant 1, mRNA
• Species: H. sapiens (human)
• Insert Size (bp): 2332
• GenBank ID: NM_030973 NM_030973
• Entrez Gene: MED25 (a.k.a. ACID1, ARC92, BVSYS, CMT2B2, P78, PTOV2, TCBAP0758)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: atctcgagccgccaccatggtccccgggtccgag
• 3′ sequencing primer: attctagactagatgagatccatgaggatg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry