pCDNA3.1-spikeRBD::∆ACE2 SURF
(Plasmid #206957)

• Purpose: Fluorescent reporter of the interaction between SARS-CoV-2 spike and human ACE2
• Depositing Lab: Xiaokun Shu
• Publication: Yang et al Nat Microbiol. 2023 Jan;8(1):121-134. doi: 10.1038/s41564-022-01288-5. Epub 2023 Jan 5.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5406
• Total vector size (bp): 9828
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: sars GU280_gp02, spike glycoprotein
• Species: SARS-CoV-2
• Insert Size (bp): 669
• Mutation: RBD (319-541)
• Entrez Gene: S (a.k.a. GU280_gp02, spike glycoprotein)
• Promoter: CMV
• Tags / Fusion Proteins:
  • cSURF (C terminal on insert)
  • mCherry (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Gene/Insert 2

• Gene/Insert name: ACE2
• Species: H. sapiens (human)
• Insert Size (bp): 1796
• Mutation: 17-615
• Entrez Gene: ACE2 (a.k.a. ACEH)
• Tags / Fusion Proteins:
  • nSURF (N terminal on insert)
  • mCherry (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (unknown if destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GCTCAGTCCACCATTGAGGAACA
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pCDNA3.1_Spike(319-541)-mCherry-SURF(85-139)_T2A_SURF(1-83)-mCherry-ACE2(17-615).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry