Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCDNA3.1-spikeRBD::∆ACE2 SURF
(Plasmid #206957)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206957 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5406
  • Total vector size (bp) 9828
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    sars GU280_gp02, spike glycoprotein
  • Species
    SARS-CoV-2
  • Insert Size (bp)
    669
  • Mutation
    RBD (319-541)
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter CMV
  • Tags / Fusion Proteins
    • cSURF (C terminal on insert)
    • mCherry (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ACE2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1796
  • Mutation
    17-615
  • Entrez Gene
    ACE2 (a.k.a. ACEH)
  • Tags / Fusion Proteins
    • nSURF (N terminal on insert)
    • mCherry (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (unknown if destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GCTCAGTCCACCATTGAGGAACA
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA3.1-spikeRBD::∆ACE2 SURF was a gift from Xiaokun Shu (Addgene plasmid # 206957 ; http://n2t.net/addgene:206957 ; RRID:Addgene_206957)
  • For your References section:

    Fluorogenic reporter enables identification of compounds that inhibit SARS-CoV-2. Yang J, Xiao Y, Lidsky PV, Wu CT, Bonser LR, Peng S, Garcia-Knight MA, Tassetto M, Chung CI, Li X, Nakayama T, Lee IT, Nayak JV, Ghias K, Hargett KL, Shoichet BK, Erle DJ, Jackson PK, Andino R, Shu X. Nat Microbiol. 2023 Jan;8(1):121-134. doi: 10.1038/s41564-022-01288-5. Epub 2023 Jan 5. 10.1038/s41564-022-01288-5 PubMed 36604514