pSA351_SCP1_intron_eGFP
(Plasmid
#206906)
-
PurposeLentiviral eGFP reporter vector with SCP1 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206906 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCCL-PGK
- Total vector size (bp) 7552
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
Insert Size (bp)717
- Promoter SCP1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACTAGCCTCGAGTCGCTGAGCTCCCTAGGGTAC
- 3′ sequencing primer TGGTGGCGACCGGTGACCTGGGAGTGGACAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSA351_SCP1_intron_eGFP was a gift from Stein Aerts (Addgene plasmid # 206906 ; http://n2t.net/addgene:206906 ; RRID:Addgene_206906) -
For your References section:
Cell type directed design of synthetic enhancers. Taskiran II, Spanier KI, Dickmanken H, Kempynck N, Pancikova A, Eksi EC, Hulselmans G, Ismail JN, Theunis K, Vandepoel R, Christiaens V, Mauduit D, Aerts S. Nature. 2023 Dec 12. doi: 10.1038/s41586-023-06936-2. 10.1038/s41586-023-06936-2 PubMed 38086419
