pcDNA3.1_hHNF4alpha
(Plasmid #206878)

• Purpose: The ORF of HNF4α (variant 2) cDNA amplified from the RT human liver RNA was cloned at the Bam HI/XbaI sites of the pcDNA3.1(+), the mammalian expression vector.
• Depositing Labs: Catharine Ross, Reza Zolfaghari
• Publication: Zolfaghari et al J Cell Biochem. 2014 Oct;115(10):1740-51. doi: 10.1002/jcb.24839.

Backbone

• Vector backbone: pcDNA3.1(+)
• Backbone size w/o insert (bp): 5428
• Total vector size (bp): 6853
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Human hepatocyte nuclear factor 4 alpha
• Alt name: HNF4alpha variant 2
• Species: H. sapiens (human)
• Insert Size (bp): 1425
• GenBank ID: NM_000457
• Entrez Gene: HNF4A (a.k.a. FRTS4, HNF4, HNF4a7, HNF4a8, HNF4a9, HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF-14, TCF14)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XbaI (unknown if destroyed)
• 5′ sequencing primer: ttggatccgccaccatgcgactctccaaaaccc
• 3′ sequencing primer: tttctagactagataacttcctgcttgg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Zolfaghari R, Bonzo JA, Gonzalez FJ, Ross AC. Hepatocyte Nuclear Factor 4α (HNF4α) Plays a Controlling Role in Expression of the Retinoic Acid Receptor β (RARβ) Gene in Hepatocytes. Int J Mol Sci. 2023 May 11;24(10):8608. doi: 10.3390/ijms24108608. PMID: 37239961; PMCID: PMC10218549.