pcDNA3.1+FLAG-KrasnatQ61R
(Plasmid #206843)

• Purpose: To express mouse Kras encoded by native mouse codons and with a Q61R mutation with an N-terminal FLAG tag.
• Depositing Lab: Christopher Counter
• Publication: Le Roux et al Elife. 2022 Sep 7;11:e75715. doi: 10.7554/eLife.75715.

Backbone

• Vector backbone: pcDNA3.1+
• Backbone size w/o insert (bp): 5428
• Total vector size (bp): 6020
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Kras
• Species: M. musculus (mouse)
• Insert Size (bp): 621
• Mutation: changed Glutamine 61 to Arginine
• GenBank ID: NM_001403240.1
• Entrez Gene: Kras (a.k.a. K-Ras, K-Ras 2, K-ras, Ki-ras, Kras-2, Kras2, c-K-ras, c-Ki-ras, p21B, ras)
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTGT
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Thermo Gene ART Gene Synthesis

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry