pBT009.119.DA9
(Plasmid
#206803)
-
PurposeExpresses DA9 scRNA for activation of pDA303
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206803 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneColE1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDA9 scRNA
-
Alt nameTGCAGCCACGTGTGAGAGTT
-
SpeciesSynthetic
- Promoter J23119
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer n/a (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBT009.119.DA9 was a gift from James Carothers (Addgene plasmid # 206803 ; http://n2t.net/addgene:206803 ; RRID:Addgene_206803) -
For your References section:
Engineering activatable promoters for scalable and multi-input CRISPRa/i circuits. Alba Burbano D, Cardiff RAL, Tickman BI, Kiattisewee C, Maranas CJ, Zalatan JG, Carothers JM. Proc Natl Acad Sci U S A. 2023 Jul 25;120(30):e2220358120. doi: 10.1073/pnas.2220358120. Epub 2023 Jul 18. 10.1073/pnas.2220358120 PubMed 37463216