Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBT009.119.DA9
(Plasmid #206803)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 206803 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    ColE1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DA9 scRNA
  • Alt name
    TGCAGCCACGTGTGAGAGTT
  • Species
    Synthetic
  • Promoter J23119

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBT009.119.DA9 was a gift from James Carothers (Addgene plasmid # 206803 ; http://n2t.net/addgene:206803 ; RRID:Addgene_206803)
  • For your References section:

    Engineering activatable promoters for scalable and multi-input CRISPRa/i circuits. Alba Burbano D, Cardiff RAL, Tickman BI, Kiattisewee C, Maranas CJ, Zalatan JG, Carothers JM. Proc Natl Acad Sci U S A. 2023 Jul 25;120(30):e2220358120. doi: 10.1073/pnas.2220358120. Epub 2023 Jul 18. 10.1073/pnas.2220358120 PubMed 37463216