pCK389
(Plasmid
#206791)
-
PurposeSp.dCas9, pTet.MCP-SoxS, J23119.gRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206791 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep15a
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namedCas9
-
SpeciesS. pyogenes
Gene/Insert 2
-
Gene/Insert nameMCP-SoxS
- Promoter Tet
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer n/a (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namescRNA
-
Alt nameTCGATCAGGTCAGAGATATG
- Promoter J23119
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer n/a (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCK389 was a gift from James Carothers (Addgene plasmid # 206791 ; http://n2t.net/addgene:206791 ; RRID:Addgene_206791) -
For your References section:
Engineering activatable promoters for scalable and multi-input CRISPRa/i circuits. Alba Burbano D, Cardiff RAL, Tickman BI, Kiattisewee C, Maranas CJ, Zalatan JG, Carothers JM. Proc Natl Acad Sci U S A. 2023 Jul 25;120(30):e2220358120. doi: 10.1073/pnas.2220358120. Epub 2023 Jul 18. 10.1073/pnas.2220358120 PubMed 37463216