AAV-RedO-shNC
(Plasmid
#206356)
-
PurposeAAV plasmid expressing non-targeting control shRNA in photoreceptors
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206356 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-RedO-WPRE-bGH
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNon-targeting control shRNA
-
gRNA/shRNA sequence5′-GCTTCGCGCCGTAGTCTTA-3′
-
SpeciesM. musculus (mouse)
- Promoter human red opsin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gacagggctttccatagcgatccggcttcgcgc
- 3′ sequencing primer ccagaggttgattggatccaAAGCTAGGGCCGCGAATTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-RedO-shNC was a gift from Connie Cepko (Addgene plasmid # 206356 ; http://n2t.net/addgene:206356 ; RRID:Addgene_206356) -
For your References section:
Txnip deletions and missense alleles prolong the survival of cones in a retinitis pigmentosa mouse model. Xue Y, Zhou Y, Cepko CL. Elife. 2024 May 10;12:RP90749. doi: 10.7554/eLife.90749. 10.7554/eLife.90749 PubMed 38727583