Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PB/pHSP-tTA-TRE-tTA-pEF1α-PuroR
(Plasmid #206213)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206213 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PB513
  • Backbone manufacturer
    System Biosciences
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tetracycline-responsive transactivator
  • Alt name
    tTA
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (unknown if destroyed)
  • 3′ cloning site NheI (unknown if destroyed)
  • 5′ sequencing primer CCCAGTCACGACGTTGTAAAACG
  • 3′ sequencing primer AGCGGATAACAATTTCACACAGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB/pHSP-tTA-TRE-tTA-pEF1α-PuroR was a gift from Masamichi Kamihira (Addgene plasmid # 206213 ; http://n2t.net/addgene:206213 ; RRID:Addgene_206213)
  • For your References section:

    Development of a genetically modified hepatoma cell line with heat-inducible high liver function. Kitano H, Nagae Y, Kawabe Y, Ito A, Kamihira M. Cytotechnology. 2021 Jun;73(3):353-362. doi: 10.1007/s10616-021-00457-4. Epub 2021 Feb 24. 10.1007/s10616-021-00457-4 PubMed 34149171