PB/pHSP-tTA-TRE-tTA-pEF1α-PuroR
(Plasmid
#206213)
-
PurposePiggyBac-based transposon vector plasmid which encodes an expression unit of tetracycline-responsive transactivator under control of HSP promoter with transcriptional amplification
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206213 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePB513
-
Backbone manufacturerSystem Biosciences
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametetracycline-responsive transactivator
-
Alt nametTA
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (unknown if destroyed)
- 3′ cloning site NheI (unknown if destroyed)
- 5′ sequencing primer CCCAGTCACGACGTTGTAAAACG
- 3′ sequencing primer AGCGGATAACAATTTCACACAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB/pHSP-tTA-TRE-tTA-pEF1α-PuroR was a gift from Masamichi Kamihira (Addgene plasmid # 206213 ; http://n2t.net/addgene:206213 ; RRID:Addgene_206213) -
For your References section:
Development of a genetically modified hepatoma cell line with heat-inducible high liver function. Kitano H, Nagae Y, Kawabe Y, Ito A, Kamihira M. Cytotechnology. 2021 Jun;73(3):353-362. doi: 10.1007/s10616-021-00457-4. Epub 2021 Feb 24. 10.1007/s10616-021-00457-4 PubMed 34149171