Skip to main content
Addgene

pTRE/VEGF/IRES/EGFP
(Plasmid #206211)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206211 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    FUGW
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    vascular endothelial growth factor
  • Alt name
    VEGF
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Vegfa (a.k.a. L-VEGF, Vegf, Vpf)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer CCTCACATTGCCAAAAGACG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRE/VEGF/IRES/EGFP was a gift from Masamichi Kamihira (Addgene plasmid # 206211 ; http://n2t.net/addgene:206211 ; RRID:Addgene_206211)

  • For your References section:

    Hypoxia-responsive expression of vascular endothelial growth factor for induction of angiogenesis in artificial three-dimensional tissues. Masumoto S, Ono A, Ito A, Kawabe Y, Kamihira M. J Biosci Bioeng. 2021 Oct;132(4):399-407. doi: 10.1016/j.jbiosc.2021.06.010. Epub 2021 Aug 4. 10.1016/j.jbiosc.2021.06.010 PubMed 34364783
Related items:
Commonly requested with: