-
PurposeInducible expression of DNA polymerase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206210 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepATetO
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePhusion DNA polymerase
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCTCCCTATCAGTGATAGAGAAAACTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pATetO 6XHis-Phusion was a gift from Andrew Ellington (Addgene plasmid # 206210 ; http://n2t.net/addgene:206210 ; RRID:Addgene_206210) -
For your References section:
Cellular reagents for diagnostics and synthetic biology. Bhadra S, Pothukuchy A, Shroff R, Cole AW, Byrom M, Ellefson JW, Gollihar JD, Ellington AD. PLoS One. 2018 Aug 15;13(8):e0201681. doi: 10.1371/journal.pone.0201681. eCollection 2018. 10.1371/journal.pone.0201681 PubMed 30110361