pBR BsmAIM
(Plasmid
#206206)
-
PurposeConstitutive expression of BsmAIM methyltransferase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206206 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneModified pCR2.1 TOPO
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBsamAIM
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTAGCTCACTCATTAGGCACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBR BsmAIM was a gift from Andrew Ellington (Addgene plasmid # 206206 ; http://n2t.net/addgene:206206 ; RRID:Addgene_206206) -
For your References section:
Producing molecular biology reagents without purification. Bhadra S, Nguyen V, Torres JA, Kar S, Fadanka S, Gandini C, Akligoh H, Paik I, Maranhao AC, Molloy J, Ellington AD. PLoS One. 2021 Jun 1;16(6):e0252507. doi: 10.1371/journal.pone.0252507. eCollection 2021. 10.1371/journal.pone.0252507 PubMed 34061896