Skip to main content
Addgene

139H2_LC
(Plasmid #206202)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206202 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pRK5
  • Backbone size w/o insert (bp) 5014
  • Total vector size (bp) 5734
  • Modifications to backbone
    3' UTR altered, multiple cloning site altered
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    anti-MUC1 antibody 139H2 light chain
  • Alt name
    139H2_LC
  • Alt name
    IgG kappa light chain
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    720
  • Entrez Gene
    Igkc (a.k.a. Igk-C)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GAAGAGGAAGAAAGGGAAAC
  • 3′ sequencing primer CTGTAATTGACAGCCTTGCC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    139H2_LC was a gift from Joost Snijder (Addgene plasmid # 206202 ; http://n2t.net/addgene:206202 ; RRID:Addgene_206202)

  • For your References section:

    Reverse-engineering the anti-MUC1 antibody 139H2 by mass spectrometry-based de novo sequencing. Peng W, Giesbers KC, Siborova M, Beugelink JW, Pronker MF, Schulte D, Hilkens J, Janssen BJ, Strijbis K, Snijder J. Life Sci Alliance. 2024 Mar 20;7(6):e202302366. doi: 10.26508/lsa.202302366. Print 2024 Jun. 10.26508/lsa.202302366 PubMed 38508723
Related items:
Commonly requested with: