139H2_HC
(Plasmid #206201)

• Purpose: For recombinant expression of the full heavy chain of the Mouse anti-MUC1 antibody 139H2 in mammalian cells. Includes a C-terminal -His8 tag for purification.
• Depositing Lab: Joost Snijder
• Publication: Peng et al Life Sci Alliance. 2024 Mar 20;7(6):e202302366. doi: 10.26508/lsa.202302366. Print 2024 Jun.

Backbone

• Vector backbone: pRK5
• Backbone size w/o insert (bp): 5014
• Total vector size (bp): 6430
• Modifications to backbone: 3' UTR altered, multiple cloning site altered
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: anti-MUC1 antibody 139H2 heavy chain
• Alt name: 139H2_HC
• Alt name: IgG1 heavy chain
• Alt name: IGHG1
• Species: M. musculus (mouse)
• Insert Size (bp): 1416
• GenBank ID: 16017
• Entrez Gene: Ighg1 (a.k.a. IgG1, Igh-4, VH7183)
• Promoter: CMV
• Tag / Fusion Protein:
  • -AAAHHHHHHHH (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GAAGAGGAAGAAAGGGAAAC
• 3′ sequencing primer: CTGTAATTGACAGCCTTGCC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry