Skip to main content
Addgene

PGK mScarlet-Synaptophysin
(Plasmid #206145)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206145 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    PGK mScarlet
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 6200
  • Modifications to backbone
    Modified from pEGFP-C1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    synaptophysin
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1500
  • Entrez Gene
    Syp (a.k.a. Syp1)
  • Promoter PGK
  • Tag / Fusion Protein
    • mScarlet (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer 5’- CACCTACAAGGCCAAGAAGC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PGK mScarlet-Synaptophysin was a gift from Erika Holzbaur (Addgene plasmid # 206145 ; http://n2t.net/addgene:206145 ; RRID:Addgene_206145)

  • For your References section:

    RAB3 phosphorylation by pathogenic LRRK2 impairs trafficking of synaptic vesicle precursors. Dou D, Aiken J, Holzbaur ELF. J Cell Biol. 2024 Jun 3;223(6):e202307092. doi: 10.1083/jcb.202307092. Epub 2024 Mar 21. 10.1083/jcb.202307092 PubMed 38512027
Related items: