Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pT2/shCol1a1/Scarlet_Seq1.3
(Plasmid #206137)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206137 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pT2
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    COL1A1
  • gRNA/shRNA sequence
    TCGAGAAGGTATATTGCTGTTGACAGTGAGCGGCAACAGTCGCTTCACCTACATAGTGAAGCCACAGATGTATGTAGGTGAAGCGACTGTTGCTGCCTACTGCCTCGG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Col1a1 (a.k.a. Col1a-1, Cola-1, Cola1, Mov-13, Mov13)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT2/shCol1a1/Scarlet_Seq1.3 was a gift from Maria Castro (Addgene plasmid # 206137 ; http://n2t.net/addgene:206137 ; RRID:Addgene_206137)
  • For your References section:

    Spatiotemporal analysis of glioma heterogeneity reveals COL1A1 as an actionable target to disrupt tumor progression. Comba A, Faisal SM, Dunn PJ, Argento AE, Hollon TC, Al-Holou WN, Varela ML, Zamler DB, Quass GL, Apostolides PF, Abel C 2nd, Brown CE, Kish PE, Kahana A, Kleer CG, Motsch S, Castro MG, Lowenstein PR. Nat Commun. 2022 Jun 24;13(1):3606. doi: 10.1038/s41467-022-31340-1. 10.1038/s41467-022-31340-1 PubMed 35750880