pT2/shCol1a1/Scarlet_Seq1.3
(Plasmid
#206137)
-
PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206137 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepT2
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCOL1A1
-
gRNA/shRNA sequenceTCGAGAAGGTATATTGCTGTTGACAGTGAGCGGCAACAGTCGCTTCACCTACATAGTGAAGCCACAGATGTATGTAGGTGAAGCGACTGTTGCTGCCTACTGCCTCGG
-
SpeciesM. musculus (mouse)
-
Entrez GeneCol1a1 (a.k.a. Col1a-1, Cola-1, Cola1, Mov-13, Mov13)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT2/shCol1a1/Scarlet_Seq1.3 was a gift from Maria Castro (Addgene plasmid # 206137 ; http://n2t.net/addgene:206137 ; RRID:Addgene_206137) -
For your References section:
Spatiotemporal analysis of glioma heterogeneity reveals COL1A1 as an actionable target to disrupt tumor progression. Comba A, Faisal SM, Dunn PJ, Argento AE, Hollon TC, Al-Holou WN, Varela ML, Zamler DB, Quass GL, Apostolides PF, Abel C 2nd, Brown CE, Kish PE, Kahana A, Kleer CG, Motsch S, Castro MG, Lowenstein PR. Nat Commun. 2022 Jun 24;13(1):3606. doi: 10.1038/s41467-022-31340-1. 10.1038/s41467-022-31340-1 PubMed 35750880