Cav2.1 HA EIA (E320A) pcDNA3
(Plasmid #206124)

• Purpose: expression of rat Cav2.1 calcium channel with a E1686R mutation to enhance expression and a mutation in the P loop of Domain I to abolish divalent cation binding
• Depositing Lab: Annette Dolphin
• Publication: Meyer et al Cell Rep. 2019 Oct 1;29(1):22-33.e5. doi: 10.1016/j.celrep.2019.08.079.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Invitrogen Life Technologies
• Backbone size w/o insert (bp): 5446
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: cacna1a
• Alt name: Cav2.1 alpha1A
• Species: R. norvegicus (rat)
• Insert Size (bp): 6858
• Mutation: E320A
• Entrez Gene: Cacna1a (a.k.a. BccA1, Cav2.1, rbA-1)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: CTGGCTAACTAGAGAACC
• 3′ sequencing primer: GCATTTAGGTGACACTATAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Terry P. Snutch

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry