Cav2.1 HA EI,II,III,IVA (E320A, E670A, E1411A, E1707A) pcDNA3
(Plasmid
#206121)
-
Purposeexpression of rat Cav2.1 calcium channel with a E1686R mutation to enhance expression and a mutation in the P loop of Domains I, II, III and IV to to abolish divalent cation binding
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206121 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen Life Technologies
- Backbone size w/o insert (bp) 5446
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecacna1a
-
Alt nameCav2.1 alpha1A
-
SpeciesR. norvegicus (rat)
-
MutationE320A, E670A, E1411A, E1707A
-
Entrez GeneCacna1a (a.k.a. BccA1, Cav2.1, rbA-1)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CTGGCTAACTAGAGAACC
- 3′ sequencing primer GCATTTAGGTGACACTATAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTerry P. Snutch
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cav2.1 HA EI,II,III,IVA (E320A, E670A, E1411A, E1707A) pcDNA3 was a gift from Annette Dolphin (Addgene plasmid # 206121 ; http://n2t.net/addgene:206121 ; RRID:Addgene_206121) -
For your References section:
Disruption of the Key Ca(2+) Binding Site in the Selectivity Filter of Neuronal Voltage-Gated Calcium Channels Inhibits Channel Trafficking. Meyer JO, Dahimene S, Page KM, Ferron L, Kadurin I, Ellaway JIJ, Zhao P, Patel T, Rothwell SW, Lin P, Pratt WS, Dolphin AC. Cell Rep. 2019 Oct 1;29(1):22-33.e5. doi: 10.1016/j.celrep.2019.08.079. 10.1016/j.celrep.2019.08.079 PubMed 31577951
