cacna2d3 BBS pMT2
(Plasmid
#206117)
-
Purposeexpression of mouse calcium channel alpha2delta-3 with a single Bungarotoxin binding site motif inserted after aa595
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206117 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMT2
-
Backbone manufacturerGenetics Institute Inc
- Backbone size w/o insert (bp) 5163
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecacna2d3
-
Alt namealpha2delta-3
-
SpeciesM. musculus (mouse)
-
Entrez GeneCacna2d3 (a.k.a. Cacnad3)
- Promoter Ad MLP/TPL/SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer AGCTTGAGGTGTGGCAGGCTT
- 3′ sequencing primer GGTCGAACCATGATGGCAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKlugbauer and Hofmann
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cacna2d3 BBS pMT2 was a gift from Annette Dolphin (Addgene plasmid # 206117 ; http://n2t.net/addgene:206117 ; RRID:Addgene_206117)