Skip to main content
Addgene

Cav2.2 HA E1658A (EIVA) pcDNA3
(Plasmid #206114)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206114 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen Life Technologies
  • Backbone size w/o insert (bp) 5446
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cacna1b
  • Alt name
    Cav2.2 alpha1B
  • Species
    O. cuniculus (rabbit)
  • Insert Size (bp)
    7160
  • Mutation
    E1658A
  • Entrez Gene
    CACNA1B
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CTGGCTAACTAGAGAACC
  • 3′ sequencing primer GCATTTAGGTGACACTATAG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Yasuo Mori

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' end of DNA is very GC rich

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cav2.2 HA E1658A (EIVA) pcDNA3 was a gift from Annette Dolphin (Addgene plasmid # 206114 ; http://n2t.net/addgene:206114 ; RRID:Addgene_206114)

  • For your References section:

    Disruption of the Key Ca(2+) Binding Site in the Selectivity Filter of Neuronal Voltage-Gated Calcium Channels Inhibits Channel Trafficking. Meyer JO, Dahimene S, Page KM, Ferron L, Kadurin I, Ellaway JIJ, Zhao P, Patel T, Rothwell SW, Lin P, Pratt WS, Dolphin AC. Cell Rep. 2019 Oct 1;29(1):22-33.e5. doi: 10.1016/j.celrep.2019.08.079. 10.1016/j.celrep.2019.08.079 PubMed 31577951
Related items:
Commonly requested with: