GFP Cav2.2 HA D665A pcDNA3
(Plasmid #206113)

• Purpose: expression of rabbit Cav2.2 with a N-terminal GFP tag and an exofacial double HA tag in domain II and a D665A mutation that allows trafficking to the plasma membrane but channel is not functional
• Depositing Lab: Annette Dolphin
• Publication: Dolphin Lab Plasmids 2023 (unpublished)

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Invitrogen Life Technologies
• Backbone size w/o insert (bp): 5446
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: cacna1b
• Alt name: Cav2.2 alpha1B
• Species: O. cuniculus (rabbit)
• Insert Size (bp): 7857
• Mutation: D665A
• Entrez Gene: CACNA1B
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: CTGGCTAACTAGAGAACC
• 3′ sequencing primer: GCATTTAGGTGACACTATAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Yasuo Mori

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

5' end of DNA is very GC rich