cacna2d1 R241A HA pMT2
(Plasmid
#206111)
-
Purposeexpression of rat alpha2delta-1 calcium channel auxillary subunit with a single HA tag inserted after aa549 and with an R421A mutation that disrupts Gabapentin binding
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206111 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMT2
-
Backbone manufacturerGenetics Institute Inc
- Backbone size w/o insert (bp) 5163
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecacna2d1
-
Alt namealpha2delta-1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)3970
-
MutationR241A
-
Entrez GeneCacna2d1 (a.k.a. CCHLA2, Cacna2, DHSCCA)
- Promoter Ad MLP/TPL/SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer AGCTTGAGGTGTGGCAGGCTT
- 3′ sequencing primer GGTCGAACCATGATGGCAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKevin Campbell
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cacna2d1 R241A HA pMT2 was a gift from Annette Dolphin (Addgene plasmid # 206111 ; http://n2t.net/addgene:206111 ; RRID:Addgene_206111) -
For your References section:
Functional exofacially tagged N-type calcium channels elucidate the interaction with auxiliary alpha2delta-1 subunits. Cassidy JS, Ferron L, Kadurin I, Pratt WS, Dolphin AC. Proc Natl Acad Sci U S A. 2014 Jun 17;111(24):8979-84. doi: 10.1073/pnas.1403731111. Epub 2014 Jun 2. 10.1073/pnas.1403731111 PubMed 24889613