Skip to main content
Addgene

Cav2.2 D122A HA pCAGGS
(Plasmid #206097)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206097 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAGGS
  • Backbone manufacturer
    PMID 11397804
  • Backbone size w/o insert (bp) 4890
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cacna1b
  • Alt name
    Cav2.2 alpha1B
  • Species
    O. cuniculus (rabbit)
  • Insert Size (bp)
    7160
  • Mutation
    D122A
  • Entrez Gene
    CACNA1B
  • Promoter CMV/B-actin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CTCTGCTAACCATGTTCATGC
  • 3′ sequencing primer CTGATAGGCAGCCTGCACCTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Yasuo Mori

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' end of DNA is very GC rich

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cav2.2 D122A HA pCAGGS was a gift from Annette Dolphin (Addgene plasmid # 206097 ; http://n2t.net/addgene:206097 ; RRID:Addgene_206097)
  • For your References section:

    The alpha(2)delta-like Protein Cachd1 Increases N-type Calcium Currents and Cell Surface Expression and Competes with alpha(2)delta-1. Dahimene S, Page KM, Kadurin I, Ferron L, Ho DY, Powell GT, Pratt WS, Wilson SW, Dolphin AC. Cell Rep. 2018 Nov 6;25(6):1610-1621.e5. doi: 10.1016/j.celrep.2018.10.033. 10.1016/j.celrep.2018.10.033 PubMed 30404013