Skip to main content
Addgene

GFP Cav2.2 DomI + DomII pMT2
(Plasmid #206095)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206095 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pMT2
  • Backbone manufacturer
    Genetics Institute Inc
  • Backbone size w/o insert (bp) 5163
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cacna1b
  • Alt name
    Cav2.2 alpha1B
  • Species
    O. cuniculus (rabbit)
  • Entrez Gene
    CACNA1B
  • Promoter Ad MLP/TPL/SV40
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer AGCTTGAGGTGTGGCAGGCTT
  • 3′ sequencing primer GGTCGAACCATGATGGCAGC
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Yasuo Mori

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' end of Cav2.2 DNA is very GC rich

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP Cav2.2 DomI + DomII pMT2 was a gift from Annette Dolphin (Addgene plasmid # 206095 ; http://n2t.net/addgene:206095 ; RRID:Addgene_206095)

  • For your References section:

    Dominant-negative synthesis suppression of voltage-gated calcium channel Cav2.2 induced by truncated constructs. Raghib A, Bertaso F, Davies A, Page KM, Meir A, Bogdanov Y, Dolphin AC. J Neurosci. 2001 Nov 1;21(21):8495-504. 21/21/8495 [pii] PubMed 11606638
Related items: