GFP Cav2.2 D122A pcDNA3
(Plasmid
#206068)
-
Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and a D122A mutation that disrupts the interaction with ?2?-1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206068 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen Life Technologies
- Backbone size w/o insert (bp) 5163
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecacna1b
-
Alt nameCav2.2 alpha1B
-
Alt nameD122A
-
SpeciesO. cuniculus (rabbit)
-
Insert Size (bp)7797
-
Entrez GeneCACNA1B
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CTGGCTAACTAGAGAACC
- 3′ sequencing primer GCATTTAGGTGACACTATAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byYasuo Mori
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' end of DNA is very GC rich
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP Cav2.2 D122A pcDNA3 was a gift from Annette Dolphin (Addgene plasmid # 206068 ; http://n2t.net/addgene:206068 ; RRID:Addgene_206068) -
For your References section:
Dominant-negative calcium channel suppression by truncated constructs involves a kinase implicated in the unfolded protein response. Page KM, Heblich F, Davies A, Butcher AJ, Leroy J, Bertaso F, Pratt WS, Dolphin AC. J Neurosci. 2004 Jun 9;24(23):5400-9. doi: 10.1523/JNEUROSCI.0553-04.2004. 10.1523/JNEUROSCI.0553-04.2004 PubMed 15190113