Skip to main content
Addgene

GFP Cav2.2 HA pcDNA3
(Plasmid #206053)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206053 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen Life Technologies
  • Backbone size w/o insert (bp) 5446
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cacna1b
  • Alt name
    Cav2.2 alpha1B
  • Alt name
    GFP Cav2.2 HA
  • Species
    O. cuniculus (rabbit)
  • Insert Size (bp)
    7857
  • Entrez Gene
    CACNA1B
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTGGCTAACTAGAGAACC
  • 3′ sequencing primer GCATTTAGGTGACACTATAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Yasuo Mori

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' end of DNA is very GC rich

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP Cav2.2 HA pcDNA3 was a gift from Annette Dolphin (Addgene plasmid # 206053 ; http://n2t.net/addgene:206053 ; RRID:Addgene_206053)
  • For your References section:

    Alternative Splicing in Ca(V)2.2 Regulates Neuronal Trafficking via Adaptor Protein Complex-1 Adaptor Protein Motifs. Macabuag N, Dolphin AC. J Neurosci. 2015 Oct 28;35(43):14636-52. doi: 10.1523/JNEUROSCI.3034-15.2015. 10.1523/JNEUROSCI.3034-15.2015 PubMed 26511252