pH2B-mNG2(11)
(Plasmid #206043)

• Purpose: Plasmid expressing a H2B-mNG2(11) fusion in mammalian cells for complementation with the mNG2(1-10) fragment.
• Depositing Lab: Alisa Piekny
• Publication: Husser et al Elife. 2024 Apr 23;12:RP92819. doi: 10.7554/eLife.92819.

Backbone

• Vector backbone: pYTK089
• Backbone size w/o insert (bp): 1874
• Total vector size (bp): 7451
• Vector type: Mammalian Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: H2B gene fused to the mNG2(11) fragment
• Alt name: H2B-mNG2(11)
• Species: H. sapiens (human)
• Insert Size (bp): 435
• Promoter: CMV
• Tag / Fusion Protein:
  • H2B-mNG2(11)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ACGGTGGGAGGTCTATATAAGCAG

Resource Information

• Supplemental Documents:
  • ph2b-mng211.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2023.06.28.546942 for bioRxiv preprint.