pFN18A-HaloTag-Biotin
(Plasmid #206039)

• Purpose: HaloTag-(Ig32)2-Talin R3-IVVI-(Ig32)2-10xHisTag-AviTag
• Depositing Lab: Sergi Garcia-Manyes
• Publication: Tapia-Rojo et al Nat Protoc. 2024 Mar 11. doi: 10.1038/s41596-024-00965-5.

Backbone

• Vector backbone: pFN18A
• Backbone manufacturer: Promega Corporation
• Backbone size w/o insert (bp): 3059
• Total vector size (bp): 5558
• Modifications to backbone: Deletion of Barnase Gene and addition of Titin (Ig32)2 domains at either side of restriction sites BspEI and NheI.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: For protein induction, use T7 Express cells with a BirA expression plasmid for biotinylation.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Talin R3-IVVI
• Species: M. musculus (mouse)
• Insert Size (bp): 2499
• Mutation: Threonine 809 to Isoleucine, Threonine 833 to Valine, Threonine 867 to Valine, Threonine 901 to IsoleucineI
• GenBank ID: NM_011602
• Entrez Gene: Tln1 (a.k.a. Tln)
• Promoter: T7
• Tags / Fusion Proteins:
  • Halo-Tag (N terminal on backbone)
  • 10 x His-AviTag (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BspEI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: CGGGTCTGAATCTGCTGCAAG
• 3′ sequencing primer: CTTCCTTTCGGGCTTTGTTAG

Resource Information

• Supplemental Documents:
  • pFN18A-HaloTag-Biotin.gb
• A portion of this plasmid was derived from a plasmid made by: Professor Julio Fernandez

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry