pFN18A-HaloTag-Biotin
(Plasmid
#206039)
-
PurposeHaloTag-(Ig32)2-Talin R3-IVVI-(Ig32)2-10xHisTag-AviTag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206039 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFN18A
-
Backbone manufacturerPromega Corporation
- Backbone size w/o insert (bp) 3059
- Total vector size (bp) 5558
-
Modifications to backboneDeletion of Barnase Gene and addition of Titin (Ig32)2 domains at either side of restriction sites BspEI and NheI.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor protein induction, use T7 Express cells with a BirA expression plasmid for biotinylation.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTalin R3-IVVI
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2499
-
MutationThreonine 809 to Isoleucine, Threonine 833 to Valine, Threonine 867 to Valine, Threonine 901 to IsoleucineI
-
GenBank IDNM_011602
-
Entrez GeneTln1 (a.k.a. Tln)
- Promoter T7
-
Tags
/ Fusion Proteins
- Halo-Tag (N terminal on backbone)
- 10 x His-AviTag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BspEI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CGGGTCTGAATCTGCTGCAAG
- 3′ sequencing primer CTTCCTTTCGGGCTTTGTTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byProfessor Julio Fernandez
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFN18A-HaloTag-Biotin was a gift from Sergi Garcia-Manyes (Addgene plasmid # 206039 ; http://n2t.net/addgene:206039 ; RRID:Addgene_206039) -
For your References section:
Single-molecule magnetic tweezers to probe the equilibrium dynamics of individual proteins at physiologically relevant forces and timescales. Tapia-Rojo R, Mora M, Garcia-Manyes S. Nat Protoc. 2024 Mar 11. doi: 10.1038/s41596-024-00965-5. 10.1038/s41596-024-00965-5 PubMed 38467905