Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFN18A-HaloTag-Biotin
(Plasmid #206039)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206039 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFN18A
  • Backbone manufacturer
    Promega Corporation
  • Backbone size w/o insert (bp) 3059
  • Total vector size (bp) 5558
  • Modifications to backbone
    Deletion of Barnase Gene and addition of Titin (Ig32)2 domains at either side of restriction sites BspEI and NheI.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For protein induction, use T7 Express cells with a BirA expression plasmid for biotinylation.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Talin R3-IVVI
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2499
  • Mutation
    Threonine 809 to Isoleucine, Threonine 833 to Valine, Threonine 867 to Valine, Threonine 901 to IsoleucineI
  • GenBank ID
    NM_011602
  • Entrez Gene
    Tln1 (a.k.a. Tln)
  • Promoter T7
  • Tags / Fusion Proteins
    • Halo-Tag (N terminal on backbone)
    • 10 x His-AviTag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspEI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CGGGTCTGAATCTGCTGCAAG
  • 3′ sequencing primer CTTCCTTTCGGGCTTTGTTAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Professor Julio Fernandez

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFN18A-HaloTag-Biotin was a gift from Sergi Garcia-Manyes (Addgene plasmid # 206039 ; http://n2t.net/addgene:206039 ; RRID:Addgene_206039)
  • For your References section:

    Single-molecule magnetic tweezers to probe the equilibrium dynamics of individual proteins at physiologically relevant forces and timescales. Tapia-Rojo R, Mora M, Garcia-Manyes S. Nat Protoc. 2024 Mar 11. doi: 10.1038/s41596-024-00965-5. 10.1038/s41596-024-00965-5 PubMed 38467905